%PDF- %PDF-
Direktori : /usr/local/go/test/bench/go1/ |
Current File : //usr/local/go/test/bench/go1/fasta_test.go |
// Copyright 2011 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style // license that can be found in the LICENSE file. package go1 import "runtime" // Not a benchmark; input for revcomp. var fastabytes = makefasta() func makefasta() []byte { var n int = 25e6 if runtime.GOARCH == "arm" || runtime.GOARCH == "mips" || runtime.GOARCH == "mips64" { // TODO(dfc) remove this limitation after precise gc. // A value of 25e6 consumes 465mb of heap on 32bit // platforms, which is too much for some systems. // A value of 25e5 produces a memory layout that // confuses the gc on 32bit platforms. So 25e4 it is. n = 25e4 } return fasta(n) } func fasta(n int) []byte { out := make(fastaBuffer, 0, 11*n) iub := []fastaAcid{ {prob: 0.27, sym: 'a'}, {prob: 0.12, sym: 'c'}, {prob: 0.12, sym: 'g'}, {prob: 0.27, sym: 't'}, {prob: 0.02, sym: 'B'}, {prob: 0.02, sym: 'D'}, {prob: 0.02, sym: 'H'}, {prob: 0.02, sym: 'K'}, {prob: 0.02, sym: 'M'}, {prob: 0.02, sym: 'N'}, {prob: 0.02, sym: 'R'}, {prob: 0.02, sym: 'S'}, {prob: 0.02, sym: 'V'}, {prob: 0.02, sym: 'W'}, {prob: 0.02, sym: 'Y'}, } homosapiens := []fastaAcid{ {prob: 0.3029549426680, sym: 'a'}, {prob: 0.1979883004921, sym: 'c'}, {prob: 0.1975473066391, sym: 'g'}, {prob: 0.3015094502008, sym: 't'}, } alu := []byte( "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA") out.WriteString(">ONE Homo sapiens alu\n") fastaRepeat(&out, alu, 2*n) out.WriteString(">TWO IUB ambiguity codes\n") fastaRandom(&out, iub, 3*n) out.WriteString(">THREE Homo sapiens frequency\n") fastaRandom(&out, homosapiens, 5*n) return out } type fastaBuffer []byte func (b *fastaBuffer) Flush() { panic("flush") } func (b *fastaBuffer) WriteString(s string) { p := b.NextWrite(len(s)) copy(p, s) } func (b *fastaBuffer) NextWrite(n int) []byte { p := *b if len(p)+n > cap(p) { b.Flush() p = *b } out := p[len(p) : len(p)+n] *b = p[:len(p)+n] return out } const fastaLine = 60 func fastaRepeat(out *fastaBuffer, alu []byte, n int) { buf := append(alu, alu...) off := 0 for n > 0 { m := n if m > fastaLine { m = fastaLine } buf1 := out.NextWrite(m + 1) copy(buf1, buf[off:]) buf1[m] = '\n' if off += m; off >= len(alu) { off -= len(alu) } n -= m } } const ( fastaLookupSize = 4096 fastaLookupScale float64 = fastaLookupSize - 1 ) var fastaRand uint32 = 42 type fastaAcid struct { sym byte prob float64 cprob float64 next *fastaAcid } func fastaComputeLookup(acid []fastaAcid) *[fastaLookupSize]*fastaAcid { var lookup [fastaLookupSize]*fastaAcid var p float64 for i := range acid { p += acid[i].prob acid[i].cprob = p * fastaLookupScale if i > 0 { acid[i-1].next = &acid[i] } } acid[len(acid)-1].cprob = 1.0 * fastaLookupScale j := 0 for i := range lookup { for acid[j].cprob < float64(i) { j++ } lookup[i] = &acid[j] } return &lookup } func fastaRandom(out *fastaBuffer, acid []fastaAcid, n int) { const ( IM = 139968 IA = 3877 IC = 29573 ) lookup := fastaComputeLookup(acid) for n > 0 { m := n if m > fastaLine { m = fastaLine } buf := out.NextWrite(m + 1) f := fastaLookupScale / IM myrand := fastaRand for i := 0; i < m; i++ { myrand = (myrand*IA + IC) % IM r := float64(int(myrand)) * f a := lookup[int(r)] for a.cprob < r { a = a.next } buf[i] = a.sym } fastaRand = myrand buf[m] = '\n' n -= m } }